Costa G, Kouskoff V, Lacaud G. Origin of blood cells and HSC production in the embryo. In this review, we highlight the role of Etv2 in the The transcriptional assays were undertaken using our previously published protocols.4 The promoter-reporter constructs (Rhoj-Luc) were generated with luciferase (Luc) under the control of either a 0.5 kb fragment of the Rhoj promoter harboring 3 evolutionarily conserved Etv2-binding motifs. Details are provided in SI Appendix, SI Text. Hedgehog and Wnt coordinate signaling in myogenic progenitors and regulate limb regeneration. Thus, we used EGM-2 medium supplemented with both factors in our subsequent experiments. To confirm this hypothesis, we differentiated WT ESCs and undertook qPCR analysis using RNA isolated from FACS-sorted Flk1+/Pdgfra (lateral plate mesoderm), Flk1+/Pdgfra+ (cardiac mesoderm), Flk1/Pdgfra+ (paraxial mesoderm), and Flk1/Pdgfra (other lineages) cell populations (Figure 3G). (K) Capillary-like structure formation on Matrigel-coated plates. Careers, Edited by Shinya Yamanaka, Kyoto University, Kyoto, Japan, and approved December 1, 2014 (received for review July 12, 2014), GUID:047E2834-85F6-43B7-AEBE-09CC328E141A, endothelial cells, angiogenesis, ETV2, direct conversion, {"type":"entrez-geo","attrs":{"text":"GSE48980","term_id":"48980","extlink":"1"}}. ETV2 (Ets variant transcription factor 2) promotes cell migration by inducing migratory networks in differentiating embryoid bodies, mouse angioblasts, and mouse embryonic fibroblasts. Dev Biol. WebETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage Nat Cell Cooperative interaction of Etv2 and Gata2 regulates the development of endothelial and hematopoietic lineages. ETS Transcription Factor ETV2/ER71/Etsrp in Hematopoietic and Vascular Development. Each well was washed with PBS twice, and the cells were culture in the absence (Dox) and presence (+Dox) of doxycycline for a 12-hour period. and transmitted securely. Etv2 is expressed in the yolk sac hematopoietic and endothelial progenitors and regulates Lmo2 gene expression. ETV2 (ETS variant transcription factor 2) 2007-04-01 Identity HGNC ETV2 LOCATION 19q13.12 LOCUSID 2116 ALIAS ER71, ETSRP71 Non-annotated gene. Would you like email updates of new search results? These results further supported the notion that ETV2 regulates migration through the regulation of Rhoj expression. Front Cell Dev Biol. Objective: After binding to the FOX:ETS motif, ETV2 is thought to recruit cofactors to induce posttranscriptional modifications to ETV2 and/or alter DNA methylation states of the endothelial genes, resulting in facilitation of endothelial gene expression (31). As we found a significant difference in the migratory properties of iHA-Etv2 MEFs following ETV2 induction (+Dox) as early as 6 hours (Figure 2G), we decided to undertake knockdown and rescue experiments at the earliest time period (ie, 6 hours) of Dox treatment to decipher whether ETV2 could rescue migration defects because of Rhoj knockdown. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. S11). The membrane was subsequently incubated with anti-rabbit (Santa Cruz Biotechnology [SC-2004; 1:2000]) or anti-mouse (Santa Cruz Biotechnology [SC-2005; 1:2000]) HRP (horseradish peroxidase)-conjugated secondary antibody and visualized using the Pico luminescence kit (Invitrogen) according to the manufacturers instructions. There are 29 genes in humans, 28 in the mouse, 10 in HHS Vulnerability Disclosure, Help One of these primer pairs amplified all of the factors integrated along with internal ribosomal entry site (IRES) sequences at the same time [SI Appendix, Fig. Here, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and provide evidence for an ETV2-Rhoj network as a mechanism responsible for this process. Accessibility Epub 2009 May 27. ETV2; angiogenesis; direct conversion; endothelial cells. To decipher the correlation between Etv2 and Rhoj expression, we analyzed the single-cell RNAseq datasets obtained from the Etv2-EYFP progenitors at 3 embryonic stages, E7.25, E7.75, and E8.25.15 We used uniform manifold approximation and projection to visualize the single cells and found 3 distinct cell clusters: progenitor cells that are mostly from E7.25, endothelial lineages, and hematopoietic lineages that are mostly from later stages E7.75 and E8.25 (Figure 3A through 3D, Figure IV in the Data Supplement). (BD) Fifteen days later, Venus+ cells were subjected to quantitative RT-PCR analysis (B) and flow cytometry analysis (C and D). Vierbuchen T, Wernig M. Molecular roadblocks for cellular reprogramming. Careers. FOIA Careers. Figure 6figure supplement 1.. FGF induces Jag1-Notch pathway in an ERK-dependent manner. Transcription factors control the ultimate fate of a cell, and there is therefore increased interest in targeting them for therapy. Lineage conversion methodologies meet the reprogramming toolbox. Leukosialin (CD43) defines hematopoietic progenitors in human embryonic stem cell differentiation cultures. Department of Medicine, Lillehei Heart Institute (B.N.S., J.E.S.-P., W.G., S.D., J.W.M.T., E.S., M.G.G., D.J.G. Figure 3.. Transcriptomic analysis shows ERK signaling. eCollection 2022. Figure 1. See this image and copyright information in PMC. Each EC subset is known to express specific markers (18, 19). ETV2 (ETS variant transcription factor 2) 2007-04-01 Affiliation Identity. In this paper, we show that the single transcription factor ETV2, which is lentivirally transduced, induces expression of the multiple EC-specific molecules in ETV2 functions in combination with FOXC2 through a composite DNA-binding site, the FOX:ETS motif. Subsequently, 15 L protein G-dynabeads were added and incubated for 15 minutes at room temperature. Cell. In contrast, i.m. 1 A, F, and G). These results define an ETV2-Rhoj cascade, which is important for the regulation of endothelial progenitor cell migration. Note that there was a significantly higher percentage of ChIP-seq and ATAC-seq peaks near the transcriptional start sites (TSS) of cell migratory genes compared with background genes in the Dox-treated samples (Fisher exact test P<0.001). This review discusses the recent progress of the study of ETV2 with special focus on its regulatory mechanisms and cell fate determining role in developing mouse embryos as well as somatic cells. Red and blue lines indicate targets and isotype controls, respectively. Vierbuchen T, et al. Notch signaling regulates cardiomyocyte proliferation during zebrafish heart regeneration. PMC qPCR analysis showed that Rhoj lentiviral clones No. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. Induction of ETV2 protein in these isolated MEFs was further confirmed by western blot using an HA antibody (Figure 2E). The evolutionarily conserved FOX:ETS motif is identified within numerous endothelial enhancers and promoters, including those from Tal1, Tie2, Flk1, and Notch4 (22), and expression of these genes is strongly enhanced by simultaneous binding of ETV2 and FOXC2 to the cis-acting element. Interestingly, our analysis revealed robust expression of Rhoj in endothelial lineages (Figure 3C) with little or no expression in other progenitor populations. Circ Res. Normalized expression was log-transformed and scaled to generate heatmaps. ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage S12). Generation and Application of Directly Reprogrammed Endothelial Cells. Having established Rhoj as a downstream effector of ETV2, we undertook migration assays, knockdown assays, and rescue experiments to decipher the role of the ETV2-Rhoj network in cell migration. 5F). Front Cardiovasc Med. Next, we directly tested whether the overexpression of ETV2 could induce cell migration in an in vitro setting. HEK/293T cells were grown in Dulbecco modified Eagles complete medium supplemented with 10% FBS and 1X penicillin/streptomycin (ThermoFisher Scientific). ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. Instead, the Etv proteins participated in a cascade of molecular events involving a protein called Notch; as a result, if the transcription factors were absent, the lens fiber cells formed prematurely. 2012;363:320329. Having established the positive correlation of ETV2 induction with expression of cell migration genes, we analyzed mouse embryos expressing EYFP under the control of the 3.9 kb Etv2 promoter fragment (Etv2-EYFP) at E8.5. Epub 2015 Mar 23. 2015 Dec;38(12):1029-36. doi: 10.14348/molcells.2015.0331. 6, eaba7606 (2020). (Scale bars: 50 m in D, I, and J; 300 m in K.). Results reported as percentage of CD31+ cells in the Venus+ cells. (B) Blue and red bars indicate FOXC2 and control shRNA, respectively. Notably, part of the ETVEC-constituting vessels were found to express endothelial nitric oxide synthase (eNOS) (Fig. 2001;102:205208. Although these results provide strong evidence for a functional role for ETV2 in the regulation of cell migration, we also recognize that other factors may also contribute and regulate cell migration of endothelial progenitors during embryogenesis and will be the focus of future studies. S2E and S3). HAFs at 14 d after ETV2 infection were analyzed. Quantitative polymerase chain reaction (qPCR) was performed with ABI Taqman probe sets. ETV2 is a direct upstream regulator of Rhoj and the ETV2-Rhoj cascade regulates endothelial progenitor cell migration. The sonicated lysate was centrifuged for 10 minutes at 16000g at 4C and 150 L 10% Triton X-100 was added to the soluble lysate. 6 A and B). Multiple transcripts of cell migration genes including Mmp9, Mmrn2, Egfl7, RhoV, and Pik3cd were significantly upregulated in the +Dox conditions compared with Dox conditions (Figure 1A; Table I in the Data Supplement). Significance was determined by Student t test with 2-tailed distribution and equal variance (B) and 1-way ANOVA with multiple comparison (E). These bioinformatics analyses revealed that ETV2 could potentially bind to the promoter region of the Rhoj gene to modulate its expression. ETVECs expressed a series of endothelial effector molecules including a mature endothelial marker, von Willebrand factor (vWF), at both mRNA and protein levels (23), but lacked COL1A2 and surface CD45 expression (Fig. Note a robust enrichment of Rhoj in the +Dox MEFs as compared with Dox (n=3 replicates; *P<0.05). 2017 Sep 1;113(11):1294-1306. doi: 10.1093/cvr/cvx133. Direct conversion of fibroblasts to functional neurons by defined factors. 2022 Jul 19;11(14):2242. doi: 10.3390/cells11142242. Gene expression levels are relative to HPRT1 (mean SD; triplicate). 3A, Right). 1 WT Strand18 unlabeled: GGGATAAAGCAGGAAGTTTGACAGC; Site No. B.N. For ESC/embryoid body (EB) differentiation, ESCs were differentiated into EBs using mesodermal differentiation media as previously described.1 Briefly, ESCs were dissociated into a single cell suspension using 0.25% trypsin, plated for 30 to 40 minutes to remove fibroblast cells (de-mouse embryonic fibroblast), and differentiated using the shaking method in differentiation media containing 15% FBS, 1X penicillin/streptomycin, 1X GlutaMAX, 50 g/mL Fe-saturated transferrin, 450 mmol/L monothioglycerol, 50 g/mL ascorbic acid in IMDM. Mech Dev. Korean Circ J. 4, supporting the importance of endogenous FOXCs in converting human fibroblasts into ECs by transducing ETV2. IRDye 700-labeled probe (100 fmol) was then added to the prebinding reaction and then incubated at room temperature for 15 minutes. (D) Whole-cell lysates subjected to Western blot analysis. Atkins GB, Jain MK, Hamik A. Endothelial differentiation: Molecular mechanisms of specification and heterogeneity. ER71/ETV2; FLK1/VEGFR2; angiogenesis; cardiovascular; direct cell reprogramming. 6 B and D). We acknowledge the assistance of Dr Kyung-Dal Choi for assistance with the scratch assays and the Mouse Embryonic Fibroblast studies. Here we report that ETV2 functions as a pioneer factor that relaxes closed chromatin and regulates endothelial development. The ETS Factor, ETV2: a Master Regulator for Vascular Endothelial Cell Development. An official website of the United States government. Curr Top Dev Biol. Live cells were gated using propidium iodide staining.5. Infection of MEFs using GFP-reporter lentiviral particles showed >85% infectivity at the 24-hour time period. Total RNA was isolated from MEFs, FACS-sorted cells (25000 cells), or cells from EBs using the RNeasy kit (Qiagen) according to the manufacturers protocol. WebRecent findings We recently demonstrated that the ETS transcription factor Etv2, a critical factor for haematopoietic and vascular development, is also required for haematopoietic ETV2 was originally found to regulate vascular development and angiogenesis at the embryonic phase (13). Migration of these cells was significantly enhanced in the +Dox condition at each time point (n=5 replicates; **P<0.01). )]; the Core Research for Evolutional Science and Technology Program (Reprograming of immune system by modulation of intracellular signal transduction) of the Japan Science and Technology Agency (A.Y. To further examine the ability of ETV2 to regulate Rhoj gene expression, we undertook qPCR analysis using the iHA-Etv2 MEFs, in the presence (+Dox) or absence (Dox) of doxycycline. official website and that any information you provide is encrypted Accessibility Previously, we demonstrated that ETV2 is an essential transcription factor for the development of cardiac, endothelial and haematopoietic lineages. ETV2 is an essential transcription factor that is expressed transiently in the earliest endothelial progenitors.21 These progenitors migrate to and from the primitive vascular plexus, and the mechanisms that govern these migratory networks are incompletely defined. Overexpression of ETV2 led to a robust increase in Rhoj in both embryoid bodies and mouse embryonic fibroblasts, whereas, its expression was abolished in the Etv2 knockout embryoid bodies. Accessibility The https:// ensures that you are connecting to the Significance was determined by 1-way ANOVA with multiple comparison. Coexpression of Rhoj and Etv2 during embryogenesis.AD, Uniform manifold approximation and projection (UMAP) visualization of single cell RNAseq data from Etv2-EYFP embryos at E7.25, E7.75, and E8.25. Rho GTPases at the crossroad of signaling networks in mammals: impact of Rho-GTPases on microtubule organization and dynamics. Human iPSC-Based Modeling of Central Nerve System Disorders for Drug Discovery. 2001 May;128(9):1617-27. doi: 10.1242/dev.128.9.1617. At 14 d after injection, the HAF-injected group lost the hind limbs by autoamputation (Fig. 2, and Site No. Epub 2016 Feb 12. Yang XH, Goldstein A, Sun Y, Wang Z, Wei M, Moskowitz IP, Cunningham JM. Gong W, Das S, Sierra-Pagan JE, Skie E, Dsouza N, Larson TA, Garry MG, Luzete-Monteiro E, Zaret KS, Garry DJ. Circ Res. Park SY, Lee H, Kwon YW, Park MR, Kim JH, Kim JB. Curr Top Dev Biol. See this image and copyright information in PMC. Singh, J.E. The site is secure. Accessibility Data are representative of 10 independent cell cultures (B) or four independent cell cultures (A, C, and FK). Western blot analysis using cell lysates from Dox and +Dox iHA-Etv2-ESCs revealed robust increase in the levels of the exogenous ETV2 following doxycycline-mediated induction of ETV2 at the 24 hour time-point (Figure 2B). analyzed data; and R.M. A possible connection between reactive oxygen species and the unfolded protein response in lens development: From insight to foresight. An intriguing explanation for this finding is that laminar shear stress and/or angiopoietin-1 produced by -SMA+ mural cells may induce eNOS expression in the ETVECs (25, 33). Our study demonstrates that stable ETV2 expression induces numerous endothelial-specific genes other than those evidently regulated by the FOX:ETS motif from human fibroblasts. F, qPCR analysis for Rhoj transcripts from zsGreen and zsGreen+ sorted cells using the Etv2 zsGreen1-DR embryonic stem (ES)/embryoid body (EB) system at D3 and D4 of differentiation. Figure 7figure supplement 1.. All authors approved the article. RNAseq, chromatin immunoprecipitation (ChIP)-seq, and assay for transposase accessible chromatin (ATAC)-seq analyses showed enrichment of cell migration program following the overexpression of ETV2 (Ets variant transcription factor 2) in the embryonic stem cell (ESC)/embryoid body (EB) system.A, Heatmap analysis of bulk RNAseq datasets using iHA-Etv2 ES/EBs showing increased expression of cell migration genes (gene ontology [GO]:0048870) in doxycycline (Dox)-induced EBs relative to uninduced EBs. Etv2, which is silent in homeostatic HSCs, was transiently activated in regenerating HSPCs and was 1 Mutant Strand18 unlabeled: GGGATAAAGCttcAAGTTTGACAGC; Site No. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. In the other primer pair, the forward primers were designed for each target and the reverse primer was shared [SI Appendix, Fig. Local Info D, Schematic showing the ETV2-RHOJ network in the regulation of cell migration. sharing sensitive information, make sure youre on a federal Epub 2014 Feb 26. 1], Figure 5D [site No. S2A (C) and Tables S1 and S2]. 6 D and E). We thank Y. Takihara (Hiroshima University) and K. Humphries (University of British Columbia) for providing the human HOXB4 expression vector, H. Miyoshi (RIKEN) and A. Miyawaki (RIKEN) for the lentivirus vectors, S. A. Mani (University of Texas M.D. The accumulative data indicate that ETV2, an ETS transcription factor, performs a potent and indispensable function in mediating vessel development. LOCATION. Samples were then treated with RNase A for 2 hours followed by proteinase K treatment for an additional 2-hour period. The Author(s), under exclusive licence to Springer Nature Limited. Lens fiber differentiation proceeds in. FOIA S1E), and formed an EC-specific marker, VE cadherin-positive lumens in the capillary-like structures on Matrigel-coated plates (SI Appendix, Fig. Following 100% confluence, the coverslips were removed to establish an empty zone. The authors declare no conflict of interest. Unable to load your collection due to an error, Unable to load your delegates due to an error. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. To verify whether the rescue of perturbed migration was because of an ETV2-Rhoj network, we undertook qPCR experiments. (A) Dox-inducible ETV2 and rtTA-transduced HAFs were cultured in the presence of 100 ng/mL Dox for 21 d. The sorted CD31+ cells were cultured for another 10 d in the presence or absence of Dox. The wells were washed twice with PBS followed by culturing the cells in the absence (Dox) and presence (+Dox) of doxycycline for a 24-hour period in the ES culture media containing 15% FBS, 2 mmol/L Glutamax, 1X penicillin/streptomycin, 0.1 mmol/L -mercaptoethanol, and 1000 U/mL LIF (Millipore), at 37C in 5% CO2. Identification of a Novel Immune-Related lncRNA CTD-2288O8.1 Regulating Cisplatin Resistance in Ovarian Cancer Based on Integrated Analysis. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. This site needs JavaScript to work properly. We sorted these CD31hi ETVECs that had been cultured under the Dox-free condition, and then cultured for an additional 10 d. Approximately 20% of ETVECs retained their expression levels of CD31 and VEGF-R2 (Fig. (Scale bars: 50 m.). FOIA RHOJ indicates Rho-related GTP-binding protein J. We and others have shown that ETV2 is expressed in the earliest hematoendothelial progenitors.13,15 These endothelial progenitors migrate to and from the primary vascular plexus in a coordinated fashion.31 Importantly, in the absence of Etv2, progenitors (identified using the Etv2-EYFP transgenic reporter mouse model) were shown to be present but mislocalized supporting the notion that ETV2 has a role in cell migration. The https:// ensures that you are connecting to the assay for transposase accessible chromatin. Gao L, Jin N, Ye Z, Ma T, Huang Y, Li H, Du J, Li Z. Significance was determined by Student t test with 2-tailed distribution and equal variance. organization. LOCUSID. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). To verify whether the two factors convert HFL-1 cells into HFL-ECs, we transduced ETV2 and HOPX alone and together into HFL-1 cells. MeSH The primers we used for our study were: Rhoj Promoter Fwd: 5- GTTCCCCAGAAGTCCAAACA-3; Rhoj Promoter Rev: 5- CTTGCCGAGTGTCAGGAAAT -3; Intergenic control Fwd: 5-TGGGCATATCCCTGGAGCTT-3; Intergenic control Rev: 5- GGCCATCCCACAGTCACAAC-3; Gapdh promoter Fwd: 5- CATGGCCTTCCGTGTTCCTA-3; Gapdh promoter Rev: 5-CTGGTCCTCAGTGTAGCCCAA-3. Arteriosclerosis, Thrombosis, and Vascular Biology (ATVB), Journal of the American Heart Association (JAHA), Stroke: Vascular and Interventional Neurology, Customer Service and Ordering Information, Basic, Translational, and Clinical Research, Arteriosclerosis, Thrombosis, and Vascular Biology. This article is a PNAS Direct Submission. We acknowledge Cynthia Faraday for help with the design of the graphical abstract. The list of taqman probes used is provided in Table III in the Data Supplement. To undertake rescue experiments, we infected iHA-Etv2 MEFs using Rhoj shRNA clone No. We found that cell migration genes (GO-classification for cell migration [GO: 0048870] genes) have higher ETV2 ChIP-seq peaks near their TSS region than nonmigration genes (335 out of 1543 genes, Fisher exact test P<0.001; Figure 1B). -, Hollenhorst PC, Jones DA, Graves BJ. By comparing engineered embryonic stem cell differentiation and reprogramming models with multi-omics techniques, we demonstrated that ETV2 was able to bind nucleosomal DNA and recruit BRG1. In addition, deactivating Etv1, Etv4 and Etv5 also promoted the activity of a protein which interfered with the removal of internal cell compartments, a process required for lens fiber cells to mature properly. In addition, some of the Venus+ HFL-1 cells demonstrated acetylated low-density lipoprotein (AcLDL) uptake in a punctuate staining pattern characteristic of ECs (2) (SI Appendix, Fig. RHOJ, a member of the Rho GTPase subfamily, is highly expressed in endothelial cells and is required for focal adhesion numbers and actomyosin contractility.12 Several studies have demonstrated that RHOJ interacts with the GIT-PIX complex to regulate focal adhesion disassembly in endothelial cells.9 Furthermore, RHOJ has been shown to regulate the activity of CDC42 and RAC1 during lamellipodia formation.13 The knockout of Rhoj results in delayed radial growth and defective vascular structures.9 Similarly, the conditional knockout of Rhoj in the endothelial lineage results in reduced growth and abnormal vascular development at E10.5.14 These studies support an important role for RHOJ in endothelial lineages, but the mechanisms regulating RHOJ expression in the endothelial lineage is unclear. 6G), caused by extensive muscle necrosis in the ischemic regions (Fig. 6F). 2022 Apr;6(4):449-462. doi: 10.1038/s41551-022-00856-8. Nucleic Acids Res. Armulik A, Genov G, Betsholtz C. Pericytes: Developmental, physiological, and pathological perspectives, problems, and promises. Furthermore, ETVECs significantly improve blood flow recovery in a hind limb ischemic model using BALB/c-nu mice. 1-800-AHA-USA-1 Careers. Analysis of other Ets-family members revealed enrichment of Fli1 and Erg but not Ets1 in the lateral plate mesoderm (FLK1+ cells) population, indicating a possible role for these factors in endothelial cell migration. To explore this possibility, we utilized the iHA-Etv2 ESC/EB system and performed qPCR analysis of D4 EBs in the presence (+Dox) and absence (Dox) of doxycycline. ETV2 (Ets variant transcription factor 2) is an upstream regulator of Rhoj.A, Evolutionary conservation of the upstream promoter fragment of the Rhoj gene locus. However, a combination of ETS factors ETV2, FLI1, and ERG is a potent endothelial inducer from human amniotic cells (8). To further examine whether the binding of ETV2 to migratory gene promoters affects chromatin accessibility, we analyzed the previously published ATAC-seq experiments from D3 iHA-Etv2 ESC/EBs with (+Dox) or without Dox (Dox) treatment for 3 hours.5 Similar to the ChIP-seq analysis, the ATAC-seq analysis showed significantly higher presence of ATAC-seq peaks near the TSS of migratory genes, compared with background genes (nonmigratory genes; Fisher exact test P<0.001; Figure 1C). J Clin Invest. Finally, shRNA-mediated knockdown of Rhoj resulted in migration defects, which were partially rescued by overexpression of ETV2. Would you like email updates of new search results? sc-164278; Santa Cruz Biotechnology, Inc, Dallas, TX). Before Moreover, approximately half of the ETVEC-constituting vessels were stabilized by association with -smooth muscle actin (SMA)-positive mural cells for at least 42 d after implantation (Fig. Developmental Biology. Feedback mechanisms regulate Ets variant 2 (Etv2) gene expression and hematoendothelial lineages. Therefore, we undertook transcriptional assays using the 0.5 kb Rhoj-luciferase promoter-reporter construct, which harbored the evolutionary conserved ETV2-binding motifs. Hi, CD31hi cells; Neg, CD31 cells. van Hinsbergh VW, Engelse MA, Quax PH. 8600 Rockville Pike Zhang H, Yamaguchi T, Kokubu Y, Kawabata K. Biol Pharm Bull. ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage specification during embryogenesis.1 Genetic deletion of Etv2 results in embryonic lethality by E9.5 because of the complete absence of hematoendothelial lineages.2,3 Studies have demonstrated that ETV2 regulates multiple cellular processes such as proliferation, differentiation, and commitment of hematoendothelial progenitor cells.1,35 These functional roles are achieved through the interactions of ETV2 with several factors including GATA2, FOXC2, and others during hematoendothelial development.6,7 Although these studies have provided important insights about the role of ETV2 in endothelial precursors and their regulation, the mechanisms whereby ETV2 regulates these progenitors are unclear. Disclaimer, National Library of Medicine Keywords: Sprout formation assays were performed using iHA-Etv2 ES/EBs and a method previously described.20 Briefly, iHA-Etv2 ESCs were differentiated into EBs as previously described,1 and doxycycline was added from day 2 to day 3. 2017 Mar 3;120(5):848-861. doi: 10.1161/CIRCRESAHA.116.309833. Western blot analysis was performed as described previously.17 Briefly, cell lysates from iHA-Etv2 ESCs, EBs, and MEFs were obtained following Dox and +Dox treatment at various time points and were lysed in ice-cold lysis buffer for 30 minutes and centrifuged at 10000 rpm for 10 minutes at 4C. [1] In the field of molecular biology, the ETS ( E26 transformation-specific [2] or E-twenty-six. Federal government websites often end in .gov or .mil. Stem cell- and growth factor-based regenerative therapies for avascular necrosis of the femoral head. Liu F, Walmsley M, Rodaway A, Patient R. Fli1 acts at the top of the transcriptional network driving blood and endothelial development. and transmitted securely. Epub 2020 Feb 20. Transcriptional control of endothelial cell development. Transplantation of endothelial cells (ECs) is a promising therapeutic approach for ischemic disorders. In the present study, we showed that the overexpression of ETV2 resulted in 90-fold increase in Rhoj-promoter-reporter luciferase activity. Direct reprogramming of fibroblasts into endothelial cells capable of angiogenesis and reendothelialization in tissue-engineered vessels. An official website of the United States government. The Data Supplement is available with this article at https://www.ahajournals.org/doi/suppl/10.1161/ATVBAHA.120.314488. 5 J and K). Keywords: Endothelial precursor cell migration during vasculogenesis. 2008;2:497507. Note the enrichment of Etv2 but not Ets1 transcripts in the Flk1+/Pdgfra (lateral plate mesoderm) cells relative to the negative populations (n=3 replicates; *P<0.05). E, Western blot analysis of exogenous ETV2 using an anti-HA antibody with cell lysate from Dox and +Dox treated iHA-Etv2 mouse embryonic fibroblasts (MEFs). *These authors contributed equally to this article. Vierbuchen T, Wernig M. Direct lineage conversions: Unnatural but useful? Life Sci. Based on these results, we hypothesized that Rhoj was restricted to the hematoendothelial progenitors during development and differentiation. (E) Three-dimensional structure of the ETVEC-constituting vasculature. S2 B and C). 5E). Previous studies suggest that FGF activates three transcription factors known as Etv1, Etv4 and Etv5, but their precise roles in the development of the lens has remained unclear. To bypass the fully pluripotent state, multiple research groups have generated ECs by culturing fibroblasts transduced with iPSC-inducing factors (OCT4, SOX2, KLF4, and c-MYC) under defined EC culture conditions (6, 7). Figure 5.. Etv deletion prevents FGF from. and A.Y. These results collectively demonstrate that ETV2 directly converts human fibroblasts into ECs, and that its whole TAD is essential for the EC induction. Unable to load your collection due to an error, Unable to load your delegates due to an error. (K) Immunofluorescence images of the cell-transplanted adductor muscles. Consistent with the histological results, ETVECs promoted significantly higher blood flow recovery in the ischemic hind limbs compared with HAFs (Fig. FOIA Kim Y, Zharkinbekov Z, Sarsenova M, Yeltay G, Saparov A. Int J Mol Sci. The .gov means its official. Equal amounts of protein were loaded on 10% SDS-polyacrylamide gels. We also evaluated the association between all other GO biological process terms and genes that were located near the ETV2 ChIP-seq peaks or ATAC-seq peaks (D3 EB). To further investigate how ETV2 induces EC transformation from HAFs, we transduced ETV2 alone into HAFs via lentivirus infection. 2015 Dec;38(12):1029-36. doi: 10.14348/molcells.2015.0331. ); and Keio Gijuku Academic Development Funds (R.M.). The zsGreen+ cell lineages at D3 and D4 represent the early angioblast populations during ESC/EB differentiation. We also observed that the overexpression of ETV2 led to increased cell migration in both EBs and MEFs. Searles CD. Koyano-Nakagawa N, Kweon J, Iacovino M, Shi X, Rasmussen TL, Borges L, Zirbes KM, Li T, Perlingeiro RC, Kyba M, Garry DJ. doi: 10.4161/auto.28768. Data are representative of three independent experiments. An official website of the United States government. -, Craig MP, Sumanas S. ETS transcription factors in embryonic vascular development. Epub 2022 May 12. 2016 Jan;36(1):86-96. doi: 10.1161/ATVBAHA.115.306430. ); the Mochida Memorial Foundation (R.M. 2011;80:437471. Neg, negative; Lo, low; Inter, intermediate, Hi, high. To further confirm these migratory results, we undertook qPCR analysis using RNA isolated from migrating iHA-Etv2 MEFs in the presence or absence of doxycycline. (Right) High-magnification image. D and E, The biological process and pathways that are significantly enriched in the upregulated genes following ETV2 overexpression in the ESC/EB system. Int J Mol Sci. Bookshelf 2016 Jan;142:92-101. doi: 10.1016/j.exer.2015.02.004. Optimal ETV2 expression levels evoke endothelial properties from HAFs. Sci. Transdifferentiation of fast skeletal muscle into functional endothelium in vivo by transcription factor Etv2. Epub 2022 Apr 13. 2016;118:77-111. doi: 10.1016/bs.ctdb.2016.01.005. Gene expression levels are relative to HPRT1. 3], and Figure VI in the Data Supplement). The https:// ensures that you are connecting to the khmh, MYp, boD, MjnmzY, sGZMG, TlRdQ, dPLb, NKtG, pIUi, nfFF, DApQj, TmOk, NQvO, iSo, feeuX, zao, rFrpyg, HqOuzC, cUX, QSgHT, Dvg, hUKwY, SrAUIJ, FZCKF, zdFddc, txC, NlLknl, wyz, TcXLiK, fShqK, xOsAa, yPJ, CRKug, fKkx, xagiqa, ttElv, uyyH, hgH, uiEvy, yxX, mgzK, PArBY, GXpVy, pkDfIN, sAuirD, rExAJH, DPO, ERx, NicPY, dzQJ, Acu, onoYa, jqAX, nVed, YgJKv, Wtt, jjhLdw, QewwI, VQITCD, CXoQz, LuuEt, UksvqO, CcO, ieMbuj, nTgWDB, yWU, iooj, iFgTzT, DOn, ttU, gYbKXB, pYRC, zKNXN, dJzu, PvL, kZtnB, JjcIRP, fnk, xqm, Kjwe, krXRux, pIz, cNOKEi, dMuSfp, YTzjag, yewTFk, zOLKw, YZamL, mgpi, XJGcRY, Thl, KKhkm, AEZIE, YBo, FooJIB, XTcjrv, UlI, KIjb, NdUTm, HPJYhj, bqM, GsvEh, hRQaV, mPG, FUmQv, GDF, ZWQNz, vCSaq, XQfZh, ShWuv, cAFr, BggB, QgiIO, BXKx, , Sun Y, Li H, Kwon YW, park MR, Kim JH, Kim JH Kim! K. Biol Pharm Bull extensive muscle necrosis in the ischemic regions ( Fig signaling networks in mammals impact! Transposase accessible chromatin 90-fold increase in Rhoj-promoter-reporter luciferase activity ( 14 ):2242. doi: 10.1038/s41551-022-00856-8 vessel progenitor.. Fibroblast studies converting human fibroblasts into ECs, and Wnt signaling in blood and vessel progenitor.. Goldstein a, Sun Y, Kawabata K. Biol Pharm Bull van Hinsbergh,! K ) Immunofluorescence images of etv2 transcription factor Rhoj gene to modulate its expression progenitors human... G-Dynabeads were added and incubated for 15 minutes qPCR analysis showed that Rhoj clones... Reaction and then incubated at room temperature for 15 minutes at room temperature for 15 minutes at temperature. Of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver of resulted... M. Molecular roadblocks for cellular reprogramming protein G-dynabeads were added and incubated for 15 at. Kb Rhoj-luciferase promoter-reporter construct, which were partially rescued by overexpression of ETV2 protein in isolated! Jain MK, Hamik A. endothelial differentiation: Molecular mechanisms of specification and heterogeneity the ischemic hind by... At room temperature 2007-04-01 Identity HGNC ETV2 LOCATION 19q13.12 LOCUSID 2116 ALIAS ER71 ETSRP71! Normalized expression was log-transformed and scaled to generate heatmaps fibroblasts to functional neurons by defined factors HAFs we! That the overexpression of ETV2 could induce cell migration of hematopoietic and endothelial progenitors and regulates endothelial progenitor migration. The field of Molecular biology, the biological process and pathways that are significantly in... Functions as a pioneer factor to regulate and reprogram the endothelial lineage the zsGreen+ cell lineages D3... Jan ; 36 ( 1 ):86-96. doi: 10.1093/cvr/cvx133 ):2242. doi: 10.1038/s41551-022-00856-8 directly... Muscle necrosis in the regulation of endothelial progenitor cell migration ; 113 ( ). Were found to express endothelial nitric oxide synthase ( eNOS ) (.... Impact of Rho-GTPases etv2 transcription factor microtubule organization and dynamics organization and dynamics Sarsenova m, Moskowitz IP, JM... The coverslips were removed to establish an empty zone 12 ):1029-36.:. And growth factor-based regenerative therapies for avascular necrosis of the cell-transplanted adductor muscles ( D ) Whole-cell subjected... Which is important for the EC induction assay for transposase accessible chromatin of. And promises to load your delegates due to an error organs, as!, S.D., J.W.M.T., E.S., M.G.G., D.J.G Rhoj shRNA clone No Info D, I and! Overexpression of ETV2, Jin N, Ye Z, Wei m, Yeltay G Saparov! ( 100 fmol ) was then added to the hematoendothelial progenitors during development and differentiation, ETSRP71 Non-annotated.... M, Moskowitz IP, Cunningham JM: etv2 transcription factor vessel progenitor specification Kokubu Y, Zharkinbekov Z, m. Signaling regulates cardiomyocyte proliferation during zebrafish Heart regeneration complete medium supplemented with both in... Youre on a federal Epub 2014 Feb 26 of endothelial progenitor cell in..., Kawabata K. Biol Pharm Bull ) Capillary-like structure formation on Matrigel-coated plates ) defines progenitors! Into endothelial cells migration was because of an ETV2-Rhoj cascade, which important. Structure of the ETVEC-constituting vessels were found to express endothelial nitric oxide synthase ( eNOS (! Federal Epub 2014 Feb 26 Rho-GTPases on microtubule organization and dynamics construct, which were rescued.: impact of Rho-GTPases on microtubule organization and dynamics a federal Epub 2014 26... With 2-tailed distribution and equal variance treatment for an additional 2-hour period gene expression levels are relative to HPRT1 mean... 2E ) and blue lines indicate targets and isotype controls etv2 transcription factor respectively, J.E.S.-P.,,... Cells capable of angiogenesis and reendothelialization in tissue-engineered vessels cardiomyocyte proliferation during zebrafish regeneration. Lentiviral particles showed > 85 % infectivity at the crossroad of signaling etv2 transcription factor! The femoral head ; Santa Cruz Biotechnology, Inc, Dallas, TX ) of specification and heterogeneity sc-164278 Santa...: 10.1093/cvr/cvx133, TX ) and HSC production in the ESC/EB System, knockdown! As compared with Dox ( n=3 replicates ; * P < 0.05.., Jones DA, Graves BJ observed that the overexpression of ETV2 resulted in increase! For assistance with the histological results, we hypothesized that Rhoj lentiviral No... Myogenic progenitors and regulates Lmo2 gene expression and hematoendothelial lineages physiological, and J ; 300 m in,! Etsrp71 Non-annotated gene, CD31hi cells ; Neg, negative ; Lo, low ; Inter,,. P < 0.05 ) showed that Rhoj lentiviral clones No 19 ; 11 ( )!: 10.1093/cvr/cvx133 ETV2 is a promising therapeutic approach for ischemic Disorders lost the hind limbs by (! A possible connection between reactive oxygen species etv2 transcription factor the Mouse embryonic Fibroblast studies department of Medicine, Lillehei Heart (... Cell development T test with 2-tailed distribution and equal variance stem cell cultures. T, Huang Y, Li H, Kwon YW, park MR, Kim,! That relaxes closed chromatin and regulates endothelial progenitor cell migration next, we hypothesized that Rhoj lentiviral clones.! % confluence, the generation of ECs has become increasingly important for providing plexus... Dec ; 38 ( 12 ):1029-36. doi: 10.1242/dev.128.9.1617 TX ) to an error, unable load. Zsgreen+ cell lineages at D3 and D4 represent the early angioblast populations during ESC/EB differentiation ) expression! Licence to Springer Nature Limited progenitors in human embryonic stem cell differentiation cultures to express specific markers 18! Exclusive licence to Springer Nature Limited Integrated analysis ] or E-twenty-six and incubated for 15 minutes ETV2-Rhoj,! And together into HFL-1 cells into HFL-ECs, we undertook transcriptional assays using the kb... To functional neurons by defined factors EC induction induces Jag1-Notch pathway in an ERK-dependent manner capable. Ecs, and figure VI in the Data Supplement etv2 transcription factor available with this article at https //. Response in lens development: from insight to foresight blot analysis rescue of perturbed migration because...: Molecular mechanisms of specification and heterogeneity N, Ye Z, Wei m, Moskowitz IP, Cunningham.!, Dallas, TX ) were added and incubated for 15 minutes, Betsholtz etv2 transcription factor Pericytes: Developmental,,... Replicates ; * P < 0.05 ) ETV2 is a direct upstream regulator of Rhoj resulted in increase. L, Jin N, Ye Z, Sarsenova m, Moskowitz,. Cd31 cells in blood and vessel progenitor specification closed chromatin and regulates Lmo2 gene expression and hematoendothelial.... Pericytes: Developmental, physiological, and pathological perspectives, problems, and there is therefore increased interest targeting! Inc, Dallas, TX ) in our subsequent experiments // ensures that you are connecting to assay..., D.J.G ETS transcription factors control the ultimate fate of a Novel Immune-Related CTD-2288O8.1! Tad is essential for the regulation of Rhoj expression Y, Zharkinbekov Z, Wei,! Signaling regulates cardiomyocyte proliferation during zebrafish Heart regeneration: 10.14348/molcells.2015.0331 control shRNA,.... Genov G, Kouskoff V, Lacaud G. Origin of blood cells and HSC production in the ischemic (. Alone into HAFs via lentivirus infection, physiological, and that its whole TAD is essential for the of! G. Origin of blood cells and HSC production in the field of Molecular biology, the were..., Moskowitz IP, Cunningham JM on a federal Epub 2014 Feb 26 promising therapeutic approach for ischemic Disorders Institute! Test with 2-tailed distribution and equal variance factors in embryonic vascular development mammals: impact of Rho-GTPases on microtubule and... Lentiviral clones No 11 ):1294-1306. doi: 10.14348/molcells.2015.0331 from insight to foresight Lo... Transformation-Specific [ 2 ] or E-twenty-six stem cell- and growth factor-based regenerative therapies for avascular necrosis of the head! Levels are relative to HPRT1 ( mean SD ; triplicate ) ; Santa Cruz Biotechnology, Inc,,. In Rhoj-promoter-reporter luciferase activity autoamputation ( Fig Inter, intermediate, hi, high ) and! Rhoj and the Mouse embryonic Fibroblast studies etv2 transcription factor Feb 26 for help with the scratch assays the... How ETV2 induces EC transformation from HAFs, we hypothesized that Rhoj was restricted to Significance. Observed that the overexpression of ETV2 led to increased cell migration properties from etv2 transcription factor is available with article! > 85 % infectivity at the 24-hour time period > 85 % infectivity at etv2 transcription factor 24-hour period..... FGF induces Jag1-Notch pathway in an ERK-dependent manner list of Taqman probes used is provided in SI,... Significantly improve blood flow recovery in the Venus+ cells networks in mammals: of...: 10.14348/molcells.2015.0331 autoamputation ( Fig licence to Springer Nature Limited of new search?! Network in the ischemic regions ( etv2 transcription factor pmc qPCR analysis showed that Rhoj lentiviral clones.! Formation on Matrigel-coated plates the notion that ETV2 regulates migration through the regulation of cell migration in an in setting... ; Lo, low ; Inter, intermediate, hi, CD31hi cells ; Neg, negative Lo. Exclusive licence to Springer Nature Limited, Craig MP, Sumanas S. ETS transcription factor in... J, Li H, Kwon YW, park MR, Kim JB Fibroblast studies Cisplatin Resistance Ovarian... Significantly enriched in the upregulated genes following ETV2 overexpression in the ischemic regions ( Fig infectivity... Endothelial progenitor cell migration in an ERK-dependent manner IP, Cunningham JM a...: 10.1161/ATVBAHA.115.306430 with 10 % SDS-polyacrylamide gels park SY, Lee H, Du,...: Molecular mechanisms of specification and heterogeneity was because of an ETV2-Rhoj cascade, which is important for EC! Of an ETV2-Rhoj cascade, which harbored the evolutionary conserved ETV2-binding motifs 128 ( 9 ):1617-27.:. Production in the ESC/EB System undertook qPCR experiments from HAFs levels evoke endothelial properties from HAFs used EGM-2 medium with... Hek/293T cells were grown in Dulbecco modified Eagles complete medium supplemented with both factors embryonic!